Top » Catalog » J1 » FGC1701

$18.00

FGC1701
[FGC1701]

FGC1701
hg38 Position: ChrY:7426495..7426495
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC11
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1701_F CCAGAATGTGGAGCCAAC
Reverse Primer: FGC1701_R ATATCTTTTCCCTCTCCCCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A24504
$18.00
Haplogroup Info
Other products
Currencies