Top » Catalog » J1 » FGC1705

$18.00

FGC1705
[FGC1705]

FGC1705
hg38 Position: ChrY:8002842..8002842
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1705_F CAGCCACATGTCACATTTCC
Reverse Primer: FGC1705_R AAAGCCCTTGGATGTTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC37530
1 x FGC2
1 x FGC41723
1 x FGC4770
1 x A13641
1 x AMM394
1 x FGC42457
1 x BY111515
1 x A21958
1 x FGC5433
1 x FGC37491
1 x B237
$216.00
Haplogroup Info
Other products
Currencies