Top » Catalog » J1 » FGC1714

$18.00

FGC1714
[FGC1714]

FGC1714
hg38 Position: ChrY:12664511..12664511
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1714_F TTACTGGGCAACTCGTTCATC
Reverse Primer: FGC1714_R CACCCTTGAATCACCAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
1 x FGC4288
1 x ALK96
1 x FGC15762
1 x FGC4767
1 x FGC12
1 x FGC34182
1 x FGC10031
1 x A19274
$540.00
Haplogroup Info
Other products
Currencies