Top » Catalog » J1 » FGC1714

$18.00

FGC1714
[FGC1714]

FGC1714
hg38 Position: ChrY:12664511..12664511
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1714_F TTACTGGGCAACTCGTTCATC
Reverse Primer: FGC1714_R CACCCTTGAATCACCAACG
Reviews

Customers who bought this product also purchased
ZS2072
ZS2072
ZS11114
ZS11114
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC1707
FGC1707
ZS11116
ZS11116
BY4
BY4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies