Top » Catalog » J1 » FGC1715

$18.00

FGC1715
[FGC1715]

FGC1715
hg38 Position: ChrY:13755865..13755865
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1696 > FGC1715
Forward Primer: FGC1715_F CGCTCTGCCTGGAAGATTAC
Reverse Primer: FGC1715_R AAATATGGAGCCCAGGGTAAG
Reviews

Customers who bought this product also purchased
FGC7937
FGC7937
ZS8525
ZS8525
FGC4262
FGC4262
ZS7288
ZS7288
FGC7936
FGC7936
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies