Top » Catalog » J1 » FGC1715

$18.00

FGC1715
[FGC1715]

FGC1715
hg38 Position: ChrY:13755865..13755865
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1696 > FGC1715
Forward Primer: FGC1715_F CGCTCTGCCTGGAAGATTAC
Reverse Primer: FGC1715_R AAATATGGAGCCCAGGGTAAG
Reviews

Customers who bought this product also purchased
FGC1712
FGC1712
M267
M267
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
HU170
HU170
FGC40709
FGC40709
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
1 x ALK473
1 x FGC5229
1 x A13637
1 x ALK609
1 x FGC8216
1 x FGC1718
1 x A19276
1 x ALK12
1 x FGC10090
1 x FGC28711
$342.00
Haplogroup Info
Other products
Currencies