Top » Catalog » J1 » FGC1720

$18.00

FGC1720
[FGC1720]

FGC1720
hg38 Position: ChrY:15638077..15638077
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC11
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1720_F TGTCTGACCTTGGCCTCAAC
Reverse Primer: FGC1720_R TAGTTCCATGGGGCTGGAG
Reviews

Customers who bought this product also purchased
FGC1723
FGC1723
FGC12
FGC12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC22259
1 x ALK899
$36.00
Haplogroup Info
Other products
Currencies