Top » Catalog » J1 » FGC1721

$18.00

FGC1721
[FGC1721]

FGC1721
hg38 Position: ChrY:16066330..16066330
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a1a
Comments: Downstream of J1-L222.2
Forward Primer: FGC1721_F ATCCACACATGTATAAAACATTCTTATCAG
Reverse Primer: FGC1721_R TGCACACAATAGCTGCAGAAC
Reviews

Customers who bought this product also purchased
ZS4760
ZS4760
ZS10813
ZS10813
ZS11604
ZS11604
ZS4082
ZS4082
ZS2050
ZS2050
BY11342
BY11342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies