Top » Catalog » J1 » FGC5231

$18.00

FGC5231
[FGC5231]

FGC5231
hg38 Position: ChrY:14787634..14787634
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5231_F GTAGACTTTTATGCCCTATTTATTTGTGC
Reverse Primer: FGC5231_R CTAATCAGGAATCCTCAGACAATATATC
Reviews

Customers who bought this product also purchased
FGC7984
FGC7984
FGC5235
FGC5235
FGC60704
FGC60704
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5206
FGC5206
FGC59067
FGC59067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18932
1 x FGC5
1 x A22918
1 x ALK341
$72.00
Haplogroup Info
Other products
Currencies