Top » Catalog » J1 » FGC7984

$18.00

FGC7984
[FGC7984]

FGC7984
hg38 Position: ChrY:12598032..12598032
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640 > FGC5206
Forward Primer: FGC7984_F CTGGAAAGAGGAGGGGAAAG
Reverse Primer: FGC7984_R AACATGCTTGGCCTCTGTTC
Reviews

Customers who bought this product also purchased
FGC15760
FGC15760
FGC59164
FGC59164
FGC15762
FGC15762
FGC5229
FGC5229
FGC5240
FGC5240
FGC5235
FGC5235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies