Top » Catalog » J1 » FGC7984

$18.00

FGC7984
[FGC7984]

FGC7984
hg38 Position: ChrY:12598032..12598032
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640 > FGC5206
Forward Primer: FGC7984_F CTGGAAAGAGGAGGGGAAAG
Reverse Primer: FGC7984_R AACATGCTTGGCCTCTGTTC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z640
Z640
FGC60653
FGC60653
FGC15760
FGC15760
FGC59164
FGC59164
FGC15762
FGC15762
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47787
1 x FGC4296
1 x FGC4751
1 x FGC48153
1 x FGC4280
1 x ALK459
1 x A22234
1 x A23463
1 x BY53798
1 x A12922
1 x FGC14439
1 x FGC4761
1 x ALK464
1 x FGC22247
1 x FGC7393
1 x FGC4297
1 x A15547
$306.00
Haplogroup Info
Other products
Currencies