Top » Catalog » J1 » FGC7984

$18.00

FGC7984
[FGC7984]

FGC7984
hg38 Position: ChrY:12598032..12598032
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640 > FGC5206
Forward Primer: FGC7984_F CTGGAAAGAGGAGGGGAAAG
Reverse Primer: FGC7984_R AACATGCTTGGCCTCTGTTC
Reviews

Customers who bought this product also purchased
FGC5231
FGC5231
FGC5206
FGC5206
FGC59067
FGC59067
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z640
Z640
FGC60653
FGC60653
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies