Top » Catalog » J1 » FGC1722

$18.00

FGC1722
[FGC1722]

FGC1722
hg38 Position: ChrY:16629835..16629835
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC11
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1722_F CACACATAACCATGCCCAAC
Reverse Primer: FGC1722_R GGAACCTCTCATATTCCACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies