Top » Catalog » J1 » FGC1723

$18.00

FGC1723
[FGC1723]

FGC1723
hg38 Position: ChrY:16841699..16841699
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1723_F TGTATGGGCAGGGCATAG
Reverse Primer: FGC1723_R GGCTGGGGTTAGGAGAGAAG
Reviews

Customers who bought this product also purchased
ZS2272
ZS2272
ZS2259
ZS2259
FGC40591
FGC40591
BY74
BY74
L174
L174
HU263
HU263
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK488
$18.00
Haplogroup Info
Other products
Currencies