Top » Catalog » J1 » FGC36044

$18.00

FGC36044
[FGC36044]

FGC36044
hg38 Position: ChrY:14968451..14968451
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: Aka ZS7569
Forward Primer: FGC36044_F TCTGTGACCCCCATAAGCTC
Reverse Primer: FGC36044_R TTGAGATGAACCAAAGGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK27
1 x FGC8729
1 x A15552
1 x ALK533
1 x ALK240
1 x ALK399
$108.00
Haplogroup Info
Other products
Currencies