Top » Catalog » J1 » FGC1731

$18.00

FGC1731
[FGC1731]

FGC1731
hg38 Position: ChrY:21820193..21820193
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC11
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1731_F ACCTGCAACAACAACACACC
Reverse Primer: FGC1731_R CACAACCAACACACCTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC29872
1 x FGC5234
$36.00
Haplogroup Info
Other products
Currencies