Top » Catalog » J1 » FGC4

$18.00

FGC4
[FGC4]

FGC4
hg38 Position: ChrY:7671796..7671796
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC3
Forward Primer: FGC4_F ACCAACATGTTTCTTTTAGTAACACG
Reverse Primer: FGC4_R CACCTGCACGAGGGCTTC
Reviews

Customers who bought this product also purchased
FGC5424
FGC5424
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS7564
ZS7564
Z18219
Z18219
ZS9904
ZS9904
ZS5613
ZS5613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies