Top » Catalog » J1 » FGC4417

$18.00

FGC4417
[FGC4417]

FGC4417
hg38 Position: ChrY:12390191..12390191
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4417_F ATTACCTGGGTGTGGTGGTG
Reverse Primer: FGC4417_R ATTCCAGGTTTTCACGATGG
Reviews

Customers who bought this product also purchased
Y14646
Y14646
FGC12
FGC12
FGC1713
FGC1713
FGC50010
FGC50010
M267
M267
BY40741
BY40741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10028
1 x ALK562
1 x FGC20885
1 x FGC22249
1 x A17832
1 x FGC43058
1 x ALK894
1 x A14647
1 x FGC4759
1 x A23491
1 x FGC50948
1 x ALK353
1 x FGC37834
1 x FGC1696
1 x FGC4309
1 x FGC45457
1 x FGC10421
1 x FGC1705
1 x FGC29847
1 x ALK490
$360.00
Haplogroup Info
Other products
Currencies