Top » Catalog » J1 » FGC4421

$18.00

FGC4421
[FGC4421]

FGC4421
hg38 Position: ChrY:13513253..13513253
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4421_F GCCCATACCAGGTTTCTGAC
Reverse Primer: FGC4421_R CTCTGGAGACTGGCCTGAAC
Reviews

Customers who bought this product also purchased
FGC60148
FGC60148
Y130515
Y130515
FGC60137
FGC60137
ZS10417
ZS10417
ZS10412
ZS10412
FGC50010
FGC50010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies