Top » Catalog » J1 » FGC4422

$18.00

FGC4422
[FGC4422]

FGC4422
hg38 Position: ChrY:14458796..14458796
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4422_F TGGCAGCATTTCATACTTGC
Reverse Primer: FGC4422_R TGCAAAATTCTGCTTTCCTG
Reviews

Customers who bought this product also purchased
BY40741
BY40741
FGC50010
FGC50010
ZS10295
ZS10295
FGC60137
FGC60137
ZS10412
ZS10412
ZS4215
ZS4215
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23924
1 x A19264
1 x B234
1 x FGC11755
1 x FGC5425
1 x FGC10030
1 x FGC8196
1 x BY259
1 x FGC23318
1 x ALK559
1 x A24503
1 x BY13766
1 x ALK723
1 x FGC5419
$252.00
Haplogroup Info
Other products
Currencies