Top » Catalog » J1 » FGC6

$18.00

FGC6
[FGC6]

FGC6
hg38 Position: ChrY:3666664..3666664
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC6_F CCATCTCTTGCATCAGAATGAG
Reverse Primer: FGC6_R ATCATATGGCAGCTGTACTTTTATTG
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
FGC51963
FGC51963
ZS11753
ZS11753
ZS7229
ZS7229
Z20775
Z20775
FGC7944
FGC7944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50880
1 x FGC4288
$36.00
Haplogroup Info
Other products
Currencies