Top » Catalog » J1 » FGC42025

$19.00

FGC42025
[FGC42025]

FGC42025
hg38 Position: ChrY:18927135..18927135
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC42025_F CCCAGGGCAGAAAACGTC
Reverse Primer: FGC42025_R ACCAGCCTGAATACCAAAGC
Reviews

Customers who bought this product also purchased
Y199426
Y199426
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies