Top » Catalog » J1 » CTS3859

$18.00

CTS3859
[CTS3859]

CTS3859
hg38 Position: ChrY:13117078..13117078
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3859_F CTGTCTGCCATCACCCG
Reverse Primer: CTS3859_R TTTTTAGTAGCTGTTTGAGTGTCCAG
Reviews

Customers who bought this product also purchased
ZS7299
ZS7299
FGC11
FGC11
FGC4480
FGC4480
ZS5010
ZS5010
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS1821
ZS1821
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies