Top » Catalog » J1 » FGC6778

$18.00

FGC6778
[FGC6778]

FGC6778
hg38 Position: ChrY:19136583..19136583
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC2 > FGC6770
Forward Primer: FGC6778_F ACAGGATGGAGAACCAATCG
Reverse Primer: FGC6778_R GCCACCTCCTTGAGTTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23319
1 x FGC22261
1 x BY11342
1 x A21959
1 x FGC50885
1 x A19161
1 x BY9
1 x FGC4453
1 x FGC14710
1 x FGC9581
$180.00
Haplogroup Info
Other products
Currencies