Top » Catalog » J1 » FGC42457

$18.00

FGC42457
[FGC42457]

FGC42457
hg38 Position: ChrY:15513002..15513002
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC42457v2_F AGGTCCTCAGACCCACCAC
Reverse Primer: FGC42457v2_R GCTAAGGGTGAAGGACCAACA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies