Top » Catalog » J1 » FGC6525

$18.00

FGC6525
[FGC6525]

FGC6525
hg38 Position: ChrY:6755793..6755793
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC6525_F TAGACTTGGGAGAGTGTACATGTCC
Reverse Primer: FGC6525_R CAGAAATAAACATGTTCTTTGAAGCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A24926
1 x FGC12861
1 x FGC20883
$54.00
Haplogroup Info
Other products
Currencies