Top » Catalog » J1 » A12919

$18.00

A12919
[A12919]

A12919
HG19 Position: ChrY:2955741..2955741
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12919_F TAATCCTTTTTGGCCTGTGG
Reverse Primer: A12919_R AAGTGGAGGGAAAGGAAAGG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC1715
FGC1715
ZS8569
ZS8569
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC42837
FGC42837
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies