Top » Catalog » J1 » A12919

$18.00

A12919
[A12919]

A12919
hg38 Position: ChrY:2955741..2955741
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12919_F TAATCCTTTTTGGCCTGTGG
Reverse Primer: A12919_R AAGTGGAGGGAAAGGAAAGG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC42837
FGC42837
FGC7
FGC7
ZS5805
ZS5805
A14638
A14638
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47834
1 x ALK877
1 x BY13768
1 x FGC4326
1 x BY108
1 x BY66740
1 x FGC22239
1 x FGC5420
1 x FGC31378
1 x A14886
1 x FGC44943
1 x FGC10612
1 x BY68
$234.00
Haplogroup Info
Other products
Currencies