Top » Catalog » J1 » A12920

$18.00

A12920
[A12920]

A12920
HG19 Position: ChrY:18890675..18890675
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12920_F TGCTTGGCTTCTTGGTAAGG
Reverse Primer: A12920_R CCCTGGGACAAAAACAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies