Top » Catalog » J1 » A12920

$18.00

A12920
[A12920]

A12920
hg38 Position: ChrY:18890675..18890675
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12920_F TGCTTGGCTTCTTGGTAAGG
Reverse Primer: A12920_R CCCTGGGACAAAAACAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10416
1 x FGC6525
1 x FGC38711
1 x FGC10422
1 x FGC4338
1 x BY145
1 x A18553
1 x FGC1722
1 x FGC23929
1 x FGC5428
1 x FGC22248
1 x FGC8716
1 x FGC19506
1 x FGC1701
1 x FGC8726
1 x FGC16654
1 x A13632
1 x FGC23369
1 x FGC4465
1 x ALK480
1 x FGC22238
$378.00
Haplogroup Info
Other products
Currencies