Top » Catalog » J1 » A12922

$18.00

A12922
[A12922]

A12922
HG19 Position: ChrY:13329565..13329565
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12922_F TGTTTTAGGCATGCGAAATG
Reverse Primer: A12922_R TTTAAGCAATGGGGGTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies