Top » Catalog » J1 » A12924

$18.00

A12924
[A12924]

A12924
hg38 Position: ChrY:13522291..13522291
Ancestral: C
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12924_F CTTCTACCCCTGTCCTGCTG
Reverse Primer: A12924_R GGGCAAATCAAATGCTTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK899
1 x BY13778
1 x ALK18
1 x FGC4420
1 x FGC29979
1 x A20821
1 x BY139864
$126.00
Haplogroup Info
Other products
Currencies