Top » Catalog » J1 » A12924

$18.00

A12924
[A12924]

A12924
HG19 Position: ChrY:13522291..13522291
Ancestral: C
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12924_F CTTCTACCCCTGTCCTGCTG
Reverse Primer: A12924_R GGGCAAATCAAATGCTTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10418
1 x ALK359
$36.00
Haplogroup Info
Other products
Currencies