Top » Catalog » J1 » A13026

$18.00

A13026
[A13026]

A13026
hg38 Position: ChrY:22214816..22214816
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: Aka Y25792
Forward Primer: A13026_F TCCTGGCAGTCTTCTTTGATG
Reverse Primer: A13026_R CCAGGTGCAGTAGCTCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies