Top » Catalog » J1 » FGC4316

$18.00

FGC4316
[FGC4316]

FGC4316
hg38 Position: ChrY:16587496..16587496
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC9
Forward Primer: FGC4316_F CTCATTTTCAGGTTTTCAGTAAAGC
Reverse Primer: FGC4316_R CTCACTTTCCATTAAACTGACTGC
Reviews

Customers who bought this product also purchased
FGC1
FGC1
ZS7229
ZS7229
FGC4243
FGC4243
FGC4340
FGC4340
ZS9483
ZS9483
FGC7944
FGC7944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies