Top » Catalog » J1 » FGC4316

$18.00

FGC4316
[FGC4316]

FGC4316
hg38 Position: ChrY:16587496..16587496
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC9
Forward Primer: FGC4316_F CTCATTTTCAGGTTTTCAGTAAAGC
Reverse Primer: FGC4316_R CTCACTTTCCATTAAACTGACTGC
Reviews

Customers who bought this product also purchased
HU326
HU326
FGC1721
FGC1721
ZS4000
ZS4000
ZS4287
ZS4287
ZS4003
ZS4003
Y82304
Y82304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY13768
1 x FGC54257
$36.00
Haplogroup Info
Other products
Currencies