Top » Catalog » J1 » FGC48145

$18.00

FGC48145
[FGC48145]

FGC48145
hg38 Position: ChrY:13620194..13620194
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48145_F CAAATACCATTTGTATTAGGCTGC
Reverse Primer: FGC48145_R TGGAATGATATGGTTTGGCTATC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41681
1 x FGC12857
$36.00
Haplogroup Info
Other products
Currencies