Top » Catalog » J1 » FGC48147

$18.00

FGC48147
[FGC48147]

FGC48147
hg38 Position: ChrY:15114661..15114661
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48147_F TGGAGCTAAAAACCAAGGCAG
Reverse Primer: FGC48147_R GGGCTTCCCTTTGTGGATAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23930
1 x FGC31133
$36.00
Haplogroup Info
Other products
Currencies