Top » Catalog » J1 » FGC48150

$18.00

FGC48150
[FGC48150]

FGC48150
hg38 Position: ChrY:16566193..16566193
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48150_F GTCCCTGATTCCTGTAAGCC
Reverse Primer: FGC48150_R TGAGACCCGAATTATGTATGCTG
Reviews

Customers who bought this product also purchased
J1-FGC48136 Shawahnet El Aqiq Panel
J1-FGC48136 Shawahnet El Aqiq Panel
FGC48146
FGC48146
FGC48153
FGC48153
FGC48145
FGC48145
FGC48151
FGC48151
FGC48143
FGC48143
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47787
1 x FGC4296
1 x FGC4751
1 x FGC48153
1 x FGC4280
1 x ALK459
1 x A22234
1 x A23463
1 x BY53798
1 x A12922
1 x FGC14439
1 x FGC4761
1 x ALK464
1 x FGC22247
$252.00
Haplogroup Info
Other products
Currencies