Top » Catalog » J1 » FGC48151

$18.00

FGC48151
[FGC48151]

FGC48151
hg38 Position: ChrY:17010165..17010165
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48151_F GCATGACATCGGCTCACC
Reverse Primer: FGC48151_R CTGAGTGAGACCATGGAATATTG
Reviews

Customers who bought this product also purchased
FGC48147
FGC48147
FGC48155
FGC48155
FGC48146
FGC48146
FGC48153
FGC48153
FGC48145
FGC48145
FGC48150
FGC48150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies