Top » Catalog » J1 » FGC48153

$18.00

FGC48153
[FGC48153]

FGC48153
hg38 Position: ChrY:19459968..19459968
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48153_F CAAATCTCAATAACCTGGTCTCC
Reverse Primer: FGC48153_R TGTCATTTGATCATGGGTCAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies