Top » Catalog » J1 » FGC48153

$18.00

FGC48153
[FGC48153]

FGC48153
hg38 Position: ChrY:19459968..19459968
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48153_F CAAATCTCAATAACCTGGTCTCC
Reverse Primer: FGC48153_R TGTCATTTGATCATGGGTCAG
Reviews

Customers who bought this product also purchased
J1-FGC48136 Shawahnet El Aqiq Panel
J1-FGC48136 Shawahnet El Aqiq Panel
FGC48155
FGC48155
FGC48146
FGC48146
FGC48151
FGC48151
FGC48145
FGC48145
FGC48150
FGC48150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC8806
$18.00
Haplogroup Info
Other products
Currencies