Top » Catalog » J1 » FGC48156

$18.00

FGC48156
[FGC48156]

FGC48156
hg38 Position: ChrY:20817427..20817427
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48156_F ACAGACATCCATGACAGATTCG
Reverse Primer: FGC48156_R TTGGCCATCTTCCTGATTTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies