Top » Catalog » J1 » FGC14709

$18.00

FGC14709
[FGC14709]

FGC14709
hg38 Position: ChrY:20791409..20791409
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC14709_F ATGGACCTTCTGCATAGCTTG
Reverse Primer: FGC14709_R CATTTGGACTGCCTCTGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50904
1 x FGC8729
1 x BY40604
1 x FGC49174
1 x ALK486
1 x A19294
$108.00
Haplogroup Info
Other products
Currencies