Top » Catalog » J1 » FGC14709

$18.00

FGC14709
[FGC14709]

FGC14709
hg38 Position: ChrY:20791409..20791409
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC14709_F ATGGACCTTCTGCATAGCTTG
Reverse Primer: FGC14709_R CATTTGGACTGCCTCTGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY13766
1 x FGC29872
$36.00
Haplogroup Info
Other products
Currencies