Top » Catalog » J1 » FGC22737

$18.00

FGC22737
[FGC22737]

FGC22737
hg38 Position: ChrY:2986818..2986818
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22737_F TTTTTAAAGACAGAATCTCACTCTGC
Reverse Primer: FGC22737_R ACTGAAGTTACAAATGAAAGAAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies