Top » Catalog » J1 » FGC22737

$18.00

FGC22737
[FGC22737]

FGC22737
hg38 Position: ChrY:2986818..2986818
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22737_F TTTTTAAAGACAGAATCTCACTCTGC
Reverse Primer: FGC22737_R ACTGAAGTTACAAATGAAAGAAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC7387
1 x FGC42829
1 x FGC7942
1 x ALK355
1 x FGC30566
1 x ALK98
1 x FGC22725
1 x FGC5430
1 x FGC8728
1 x FGC1729
1 x A24504
1 x ALK876
1 x FGC50901
1 x FGC10419
1 x ALK886
1 x FGC10601
1 x FGC3723
1 x FGC1687
1 x FGC8730
1 x FGC12805
1 x FGC44938
$378.00
Haplogroup Info
Other products
Currencies