Top » Catalog » J1 » FGC22744

$18.00

FGC22744
[FGC22744]

FGC22744
hg38 Position: ChrY:6778054..6778054
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22744_F TTTTGAGTCTTGCTCTGCCAC
Reverse Primer: FGC22744_R GTATATGTCTAATGTTAATTAAGCATGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies