Top » Catalog » J1 » FGC22748

$18.00

FGC22748
[FGC22748]

FGC22748
hg38 Position: ChrY:12337449..12337449
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC22748_F ACATGTGGCCTACCACTGTG
Reverse Primer: FGC22748_R CAGCTGGGATTACAGATGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20817
$18.00
Haplogroup Info
Other products
Currencies