Top » Catalog » J1 » FGC22749

$18.00

FGC22749
[FGC22749]

FGC22749
hg38 Position: ChrY:13684217..13684217
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC22749_F GAAAAGAAAATTCCAGGCAAATAG
Reverse Primer: FGC22749_R TTCCTATTTGAATACACTTTATTTGTTCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10028
1 x ALK562
1 x FGC20885
1 x FGC22249
1 x A17832
$90.00
Haplogroup Info
Other products
Currencies