Top » Catalog » J1 » FGC29860

$18.00

FGC29860
[FGC29860]

FGC29860
hg38 Position: ChrY:6930693..6930693
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1695 > BY8 > BY9 > BY136
Forward Primer: FGC29860_F TGGATGTAGTGGCTCACACC
Reverse Primer: FGC29860_R GGGACCTGAGTAGGTTGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC37530
1 x FGC2
1 x FGC41723
1 x FGC4770
1 x A13641
1 x AMM394
1 x FGC42457
1 x BY111515
1 x A21958
$162.00
Haplogroup Info
Other products
Currencies