Top » Catalog » J1 » FGC29863

$18.00

FGC29863
[FGC29863]

FGC29863
hg38 Position: ChrY:15618867..15618867
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1695 > BY8 > BY9 > BY136 > ZS2028
Forward Primer: FGC29863v2_F AAAGAGTAGGGGCCAATATTCAG
Reverse Primer: FGC29863v2_R ACAGAACACCAATTCATCTCGAC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
ZS2010
ZS2010
FGC12
FGC12
Z18231
Z18231
L858
L858
ZS2028
ZS2028
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47834
1 x ALK877
1 x BY13768
1 x FGC4326
1 x BY108
1 x BY66740
1 x FGC22239
1 x FGC5420
1 x FGC31378
1 x A14886
1 x FGC44943
1 x FGC10612
1 x BY68
$234.00
Haplogroup Info
Other products
Currencies